View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_high_8 (Length: 315)
Name: NF18789_high_8
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 20 - 306
Target Start/End: Complemental strand, 37135421 - 37135135
Alignment:
| Q |
20 |
ttcagaaaatgaaccctttttaagattcggcctcagatgattagcccatctaagtctgcagctttttccacaccttaacaatcctgaattcttctgaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135421 |
ttcagaaaatgaaccctttttaagattcggcctcagatgattagcccatctaagtctgcagctttttccacaccttaacaatcctgaattcttctgaaca |
37135322 |
T |
|
| Q |
120 |
aaattccaattcccttcaccatgcttattcacgtactctgtcaaaatcatgtcttcatgtggggtccacggtcccttcttcatgccagttctagcatcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135321 |
aaattccaattcccttcaccatgcttattcacgtactctgtcaaaatcatgtcttcatgtggggtccacggtcccttcttcatgccagttctagcatcaa |
37135222 |
T |
|
| Q |
220 |
catcgtcttttgatgaatcaatgtcaacctcaacattttcatcgttgttcgagatcgttttcgccataattaatttaccacctttgc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135221 |
catcgtcttttgatgaatcaatgtcaacctcaacattttcatcgttgttcgagatcgttttcgccataattaatttaccacctttgc |
37135135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 107
Target Start/End: Original strand, 33732242 - 33732280
Alignment:
| Q |
69 |
ctaagtctgcagctttttccacaccttaacaatcctgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33732242 |
ctaagtctgcagctttttccacaccttaacaagcctgaa |
33732280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University