View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_low_11 (Length: 346)
Name: NF18789_low_11
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 13 - 330
Target Start/End: Complemental strand, 28035941 - 28035624
Alignment:
| Q |
13 |
gagtagcaaagggagagaatttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttact |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035941 |
gagtatcaaagggagagaatttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttact |
28035842 |
T |
 |
| Q |
113 |
atttgtcatacaattacagaatcaagagctcttttgtgtttcgcggttttgttggaaaagggtacagatgatgtgcaacattattcagcaatggctttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28035841 |
atttgtcatacaattacagaatcaagagctcttttgtgttttgcggttttgttggaaaagggtactgatgatgtgcaacattattcagcaatggctttga |
28035742 |
T |
 |
| Q |
213 |
tggaaataacatctgtggcagcagaacatgcagaattgagacgctctgctttcaaaccaactgcccctgctgcaaaagctgtggtggaacagtttctcaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035741 |
tggaaataacatctgtggcagcagaacatgcagaattgagacgttctgctttcaaaccaactgcccctgctgcaaaagctgtggtggaacagtttctcaa |
28035642 |
T |
 |
| Q |
313 |
agttgtcgaaaaaggtga |
330 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
28035641 |
agttgttgaaaaaggtga |
28035624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University