View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_low_16 (Length: 299)
Name: NF18789_low_16
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 126 - 284
Target Start/End: Original strand, 29672951 - 29673109
Alignment:
| Q |
126 |
aggaaaaggtagtgttgtttgaagtgagcatgagattttgttgttttgggagatagatcttttcttctttaaagtgattgaatttgatcttgaatctttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672951 |
aggaaaaggtagtgttgtttgaagtgagcatgagattttgttgttttgggagatagatcttttcttctttaaagtgattgaatttgatcttgaatctttg |
29673050 |
T |
|
| Q |
226 |
aaaggagaagagtatgaagatgatgaaccaagtttggtgttaatccatgtgtttgatga |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29673051 |
aaaggagaagagtatgaagatgatgaaccaagtttggtgttaatccatgtgtttgatga |
29673109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University