View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_low_20 (Length: 240)
Name: NF18789_low_20
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 20076940 - 20076795
Alignment:
| Q |
1 |
ttgcaacctttcactaatgagtttgaatcttcattctttaaattcactacatgctccggtcttaaatgtctctcaccccattaacaacaccaccatcaac |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20076940 |
ttgcaacctttcactaatgagttcgaatcttctttctttaaattcactacatgctccggtcttaaatgtctctcaccccattaacaacaccaccatcaac |
20076841 |
T |
|
| Q |
101 |
aacatccacg--acgtatgaacctaggtttcaatttgattacatgg |
144 |
Q |
| |
|
|||||||| | | ||||||||||| | || ||||||||||||||| |
|
|
| T |
20076840 |
aacatccatggcatgtatgaacctaagctttaatttgattacatgg |
20076795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 20076761 - 20076716
Alignment:
| Q |
179 |
ctctaccaaatttcttgctttccttttgtgatctgggtgttatgct |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20076761 |
ctctaccaaatttcttgctttctttttgtgatctgggtgttatgct |
20076716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University