View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_low_21 (Length: 240)
Name: NF18789_low_21
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 29404860 - 29405087
Alignment:
| Q |
9 |
tggacatcctcaagtcccattccaacataagacatcactatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaattcagttcgagtcc |
108 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29404860 |
tggacatcatcaattcccattccaacatccgacatccctatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaactcagttcgagtcc |
29404959 |
T |
|
| Q |
109 |
aaactcattacgactcagacatgtcaacacaccaagtagatgacctcgatccatcagatgaatccaatgctccagctagcaggccaaaattcactcgtgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29404960 |
aaactcattacgactcagacatgtcaacacaccaagtagatgagctcgatccatcagatgaatccaatgctccagctagcaggccaaaattcactcgtgg |
29405059 |
T |
|
| Q |
209 |
gagctcaactcggttcacggcagattcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29405060 |
gagctcaactcggttcacggcagattcc |
29405087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 136
Target Start/End: Complemental strand, 19911915 - 19911822
Alignment:
| Q |
46 |
ctatccaaaatccaaacagcagaagcttttcacaattcggtcgtcgcaattcagttcgagtccaaactcattac---gactcagacatgtcaac |
136 |
Q |
| |
|
||||||||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||| |||||||||| || ||||||||||||||||| |
|
|
| T |
19911915 |
ctatccaaaatcctaatagtagaagtttttctcaattcggtcgtcgcaactcagtccgaatccaaactcaccacgatgactcagacatgtcaac |
19911822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University