View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18789_low_28 (Length: 227)

Name: NF18789_low_28
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18789_low_28
NF18789_low_28
[»] chr8 (1 HSPs)
chr8 (24-206)||(14480116-14480314)
[»] chr5 (1 HSPs)
chr5 (46-115)||(38749553-38749622)
[»] chr3 (1 HSPs)
chr3 (54-115)||(21148747-21148807)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 14480116 - 14480314
Alignment:
24 agacacgaacacattgacacttgacaccgataataatttggaaaaatgataaaattgaaagtaatcacatgcgttgttgttgtgtcggacacc------- 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||           
14480116 agacacgaacacattgacacttgacaccgataataatttggaaaaatgacaaaattgaaagtaatcacatgcgttgttgttttgtcggacaccggacgtg 14480215  T
117 ---------agacatgtcactacagagtgtgtgagtgtaacgtgtttgtagaaaatgaaccaattattcactgctgcataggaattaaggctaaactat 206  Q
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14480216 tctttgatgagaagtgtcactacagagtgtgtgagtgtaacgtgtttgtagaaaatgaaccaattattcactgctgcataggaattaaggctaaactat 14480314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 115
Target Start/End: Complemental strand, 38749622 - 38749553
Alignment:
46 gacaccgataataatttggaaaaatgataaaattgaaagtaatcacatgcgttgttgttgtgtcggacac 115  Q
    |||||||||||||||||| |||||||| | |||| || ||||| | ||| |||| |||||||||||||||    
38749622 gacaccgataataatttgaaaaaatgacataattcaatgtaattatatgtgttggtgttgtgtcggacac 38749553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 115
Target Start/End: Original strand, 21148747 - 21148807
Alignment:
54 taataatttggaaaaatgataaaattgaaagtaatcacatgcgttgttgttgtgtcggacac 115  Q
    |||||||||| |||||||| ||||| ||| ||||| ||||| |||| |||||||||||||||    
21148747 taataatttg-aaaaatgacaaaatggaatgtaatgacatgagttggtgttgtgtcggacac 21148807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University