View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_high_9 (Length: 351)
Name: NF1878_high_9
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 38326275 - 38325930
Alignment:
| Q |
1 |
cataatatatgcttcagagactttggaagtaggatctgcattaagaatcagaacgaaaaatcaagttaattttgttattagcagatatatagtcgtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326275 |
cataatatatgcttcagagactttggaagtaggatctgcattaagaatcagaacgaaaaatcaagttaattttgttattagcagatatatagtcgtttta |
38326176 |
T |
 |
| Q |
101 |
taggagtgatcgcatagctcttatgaagagtaaatagtcgttttagtctctaaatgttgaggcgttgtcaacaagtaggaaactagaaaaggagagcgac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326175 |
taagagtgatcgcatagctcttatgaagagtaaatagtcgttttagtctctaaatgttgaggcgttgtcaacaagtaggaaactagaaaaggagagcgac |
38326076 |
T |
 |
| Q |
201 |
cacattttgcttttggaaggcccaccactttgcttcataggaccgacaacgaagccctgtaaaggcaaacagctggtattgctcgctcttgcccttaaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326075 |
cacattttgcttttggaaggcccaccacttttcttcataggaccggcaacgaagccctataaaggcaaacagctggtattgctcgctcttgcccttaaat |
38325976 |
T |
 |
| Q |
301 |
atatcgatactacaaaattattccagagcttgtcttctcttagtag |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325975 |
atatcgatattacaaaattattccagagcttgtcttctcttagtag |
38325930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University