View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_low_10 (Length: 383)
Name: NF1878_low_10
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 192 - 368
Target Start/End: Original strand, 13481283 - 13481459
Alignment:
| Q |
192 |
atggattttcatcttggtaatggtttatcttttccaagacttcaacttcataatcaccctcaaatttctactactcctatgtataaccagttttcatctt |
291 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13481283 |
atggattttcatcttggtagtggtttatcttttccaagacttcaacttcataatcaccctcaaatttctactactcctatgtataaccagttttcatctt |
13481382 |
T |
 |
| Q |
292 |
ttggagaaacttcttctgctatgaataataactatcatgcttcttcaaattctgctgctgctatgaactatcctttt |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13481383 |
ttggagaaacttcttctgctatgaataataactatcatgcttcttcaaattctgctgctgctatgaactatcctttt |
13481459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 15 - 129
Target Start/End: Original strand, 13481106 - 13481220
Alignment:
| Q |
15 |
agatattggacaaaaggtggagctttacgcaacgttccaatcggtggtggatgtagaaaaaacaagaaaatgaaatcatcatcatcaagactctcttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13481106 |
agatattggacaaaaggtggagctttacgcaacgttccaatcggtggtggatgtagaaaaaacaagaaaatgaaatcatcatcatcaagactctcttgtg |
13481205 |
T |
 |
| Q |
115 |
attcaaaagactcag |
129 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13481206 |
attcaaaagactcag |
13481220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University