View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_low_14 (Length: 300)
Name: NF1878_low_14
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 43758734 - 43758521
Alignment:
| Q |
73 |
aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtccacacgttcgatcaccctt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758734 |
aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtccacacgttcgatcaccctt |
43758635 |
T |
 |
| Q |
173 |
ttctttccccatttacacccgttgatttttccttcattttccaattcaccatatctcgccacaattataggtcttgctatttttattttcaaaataaata |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758634 |
ttctttccccatttacacccgttgatttttccttcattttccaattcaccatatctcgccacaattataggtcttgctatttttattttcaaaataaata |
43758535 |
T |
 |
| Q |
273 |
aattattttctatt |
286 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43758534 |
aattattttctatt |
43758521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University