View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_low_16 (Length: 288)
Name: NF1878_low_16
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 4 - 272
Target Start/End: Complemental strand, 32524936 - 32524671
Alignment:
| Q |
4 |
aaattggttgaaattaataataaggagatttgaattgagacctcactccaaagatttaagccagcaccactagactagttcaaatgggttgtttctgaac |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||| |||| |||||||| ||||| |
|
|
| T |
32524936 |
aaattggttgaaattgataataaggagatttgaattgagatctcactccaaagatttaagccagcaccattacactagtttaaatcggttgtttatgaac |
32524837 |
T |
 |
| Q |
104 |
tacttgttgtaattgcataattaaaggattaaattgaaatgtgagagatagcttaggaattaaattgatggtttatcttttgatttagttagttgaaggc |
203 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32524836 |
tacttattgtaattgcataattaatggattaaattgaaatatgaaagatagctcaggaattaaattgatggtttatcttttgatttagttagctgaaggg |
32524737 |
T |
 |
| Q |
204 |
catgttgcgattgtgtttatccaacgatgaagtgttgtttaattaatagtaggtcatagaaaaatttta |
272 |
Q |
| |
|
||| || ||||||||||||||||| |||||||||| |||||| ||| ||||||||||| |||||||| |
|
|
| T |
32524736 |
catcttacgattgtgtttatccaaagatgaagtgtcgtttaactaa---taggtcatagagaaatttta |
32524671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University