View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1878_low_17 (Length: 280)

Name: NF1878_low_17
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1878_low_17
NF1878_low_17
[»] chr1 (1 HSPs)
chr1 (1-132)||(25138407-25138538)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 25138538 - 25138407
Alignment:
1 tgaattgatgtgtattcgatgccttatgttcttcactgtatttggaatcccttttctcttttttgaccctccaaaatttgtcactttactcgtatagaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25138538 tgaattgatgtgtattcgatgccttatgttcttcactgtatttcgaatcccttttctcttttttgaccctccaaaatttgtcactttactcgtatagaaa 25138439  T
101 tggaagtttagtctttttgaggggaaatggaa 132  Q
    ||||||||||||||||||||||||||||||||    
25138438 tggaagtttagtctttttgaggggaaatggaa 25138407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University