View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_low_17 (Length: 280)
Name: NF1878_low_17
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 25138538 - 25138407
Alignment:
| Q |
1 |
tgaattgatgtgtattcgatgccttatgttcttcactgtatttggaatcccttttctcttttttgaccctccaaaatttgtcactttactcgtatagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25138538 |
tgaattgatgtgtattcgatgccttatgttcttcactgtatttcgaatcccttttctcttttttgaccctccaaaatttgtcactttactcgtatagaaa |
25138439 |
T |
 |
| Q |
101 |
tggaagtttagtctttttgaggggaaatggaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25138438 |
tggaagtttagtctttttgaggggaaatggaa |
25138407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University