View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1878_low_21 (Length: 238)
Name: NF1878_low_21
Description: NF1878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1878_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 43 - 226
Target Start/End: Complemental strand, 10613277 - 10613094
Alignment:
| Q |
43 |
ccgcattctgttctatgttgtgttcactgccctcacccgactttcctagctgcgtccacttacaacgaccatggccgccatcaaccacagttagccattg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10613277 |
ccgcattctgttctatgttgtgttcactgccctcacccaactttcctagctgcttccacttacaacgaccatggccgccatcaaccacagttagccattg |
10613178 |
T |
 |
| Q |
143 |
tgctagaacactttccagaaaaacctccaccattcgaaccactgtgtactgatcttgaacgtcacaaaaccttcagcctctctg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10613177 |
tgctagaacactttccagaaaaacctccaccattcgaaccactgtgtactgatcttgaacgtcacaaaaccttcagcctttctg |
10613094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University