View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18790_high_20 (Length: 250)
Name: NF18790_high_20
Description: NF18790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18790_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 26219282 - 26219514
Alignment:
| Q |
1 |
tgcttctcacctttattgacttctatccaatgggttcgagatttatatcttaccaatgtagattttgaacttgattctctgaatgtggtatccaaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26219282 |
tgcttctcacctttattgacttctatccaatgggttcgagatttatatcttaccaatgtagattttgaacttgattctctgaatgtggtatccaaatttc |
26219381 |
T |
|
| Q |
101 |
ttattagaggagaagacaactcggattttggtgttatttttcaggaatcaggattgtcgtagaattgatggttcgatttttacaaattagtgtgttgaat |
200 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26219382 |
ttactagaggagaagagaactcggattttggtgttatttttcaggaatcaggattgtcgtagaattgatggttcgatttttacaaattattgtgttgaat |
26219481 |
T |
|
| Q |
201 |
ttactagaagacaagcaactgaggttgcccaca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26219482 |
ttactagaagacaagcaactgaggttgcccaca |
26219514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University