View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18790_low_16 (Length: 338)
Name: NF18790_low_16
Description: NF18790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18790_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 323
Target Start/End: Original strand, 7589688 - 7590007
Alignment:
| Q |
16 |
gaatcagaagcaccagcatcttctccaaaagctaccacttcagcaccaacaccagcaccttcaaccgatgctcctgtctcttcacccg------------ |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7589688 |
gaatcagaagcaccagcatcttctccaaaagctaccacttcagcaccaacaccagcaccttcaactgatgctcctgtctcttcacccgaggcttcacctg |
7589787 |
T |
 |
| Q |
104 |
cctcttcacccgaggctgatgaagaaatttcatctccaccatcaccatcccctgctgatgatctcttcgctcctggaactgcccctgcttctgatgacgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
7589788 |
cctcttcacccgaggctgatgaagaaatttcatctccaccatcaccatcccctgctgatgatctcttcgctcctggatccgcccctgcttctgatgacgt |
7589887 |
T |
 |
| Q |
204 |
ggctcccgctgccgccccaactgctgatgaggccgctgcatcatctcttcgcttctctgctgccgctgtcactgttgtcgttgccggcttctttgccttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
7589888 |
ggctcccgctgccgccccaactgctgatgaggccgctgcatcatctcttcgcttctctgctgccgctgccaccgttgtcgttgccggcttctttgccttt |
7589987 |
T |
 |
| Q |
304 |
taattgagcaagctataact |
323 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
7589988 |
taattgtgcaagctataact |
7590007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University