View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18791_high_16 (Length: 250)
Name: NF18791_high_16
Description: NF18791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18791_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 45360064 - 45359841
Alignment:
| Q |
17 |
aagaacatgatggtcactttgttggatatcataggtggttacatagctgttctgagttgttggtgtgggtaagtttcttgatttttagttgtcagcttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360064 |
aagaacatgatggtcactttgttggatatcataggtggttacatagctgttctgagttgttggtgtgggtaagtttcttgatttttagttgtcagcttct |
45359965 |
T |
 |
| Q |
117 |
caagagtttaatgcatttgatttcttgtgatttaaatctccacttatgcctatatgtaggcaaatatcattctcttcacaaagtgtgcaagcattcattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45359964 |
caagagtttaatgcatttgatttcttgtgatttaaatctccacttatgcctatatgtaggcaaatatcattctcttcacaaagtgtgcaagcattcattg |
45359865 |
T |
 |
| Q |
217 |
catagtcttcaaccgtgtcctatg |
240 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
45359864 |
catagtcttcaaccgtgtcttatg |
45359841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University