View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18791_low_10 (Length: 344)
Name: NF18791_low_10
Description: NF18791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18791_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 31 - 327
Target Start/End: Complemental strand, 42468354 - 42468037
Alignment:
| Q |
31 |
caacttaatagagttgaga--acttttttgacatatttgagagtgtccgacaaaatcagagacta-------------------tcttctatcttacttg |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42468354 |
caacttaatagagttgagagaacttttttgacatatttgagagtgtccgacaaaatcagagactaatttggtgatatagtcgtatcttctatcttacttg |
42468255 |
T |
|
| Q |
110 |
tttacaacgtttgggagcttactggcaatttacaaatttttcacagccagtttgcaatatatgatgattttgatgacgatgctgttgtggatgttaagat |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42468254 |
tttacaacgtttgagagcttactggcaatttacaaatttttcacagccagtttgcaacatatgatgattttgatgacgatgctgttgtggatgttaagat |
42468155 |
T |
|
| Q |
210 |
gcctactggactgtataatggttctgtctcatgtaaagtttcacagtttattaaggctaacaggaagaaaccaaaggtactaaaattaagattttataga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| || |
|
|
| T |
42468154 |
gcctactggactgtataatggttctgtctcatgtaaagtttcacagtttattaaggctaacaagaagaaactaaaggtactaaaattaagattttattga |
42468055 |
T |
|
| Q |
310 |
tagatacatgttatctgt |
327 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42468054 |
tagatacatgttatctgt |
42468037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University