View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18793_high_27 (Length: 245)
Name: NF18793_high_27
Description: NF18793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18793_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 69 - 229
Target Start/End: Complemental strand, 10251778 - 10251618
Alignment:
| Q |
69 |
atcaagttgacctctgtgatggtttgaggaattcaggacttcaaacattcttaatacaagtttcttccatatggatttgaatcataaacaaatttcaaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10251778 |
atcaagttgacctctgtgatggtttgaggaattcaggacttcaaacattcttaatacaagtttcttccatttggatttgaatcataaacaaatttcaaat |
10251679 |
T |
|
| Q |
169 |
gaattaagtttagtctaaatagtttggtgatagagaagcacgtttctctctcttcgaaaat |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251678 |
gaattgagtttagtctaaatagtttggtgatagagaagcacgtttctctctcttcgaaaat |
10251618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University