View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18793_high_30 (Length: 236)
Name: NF18793_high_30
Description: NF18793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18793_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 18858355 - 18858129
Alignment:
| Q |
1 |
agcagaagaagtaccaactttgattcttttgactctgaattttttcaaagagtgtttgattctacgcatcgcagggacgagatgaagccacgtggagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18858355 |
agcagaagaagtaccaactttgattcttttgactctgaattttttcaaagagtgtttgattctacgcatcgcagggacgaggtgaagccacgtggagttt |
18858256 |
T |
 |
| Q |
101 |
ggtgtggatgagatgatttcgtttcctacaaggaggtaacggattagggtttgtgggtaataaggtagaatgttggatttgatccattggtcggagagag |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18858255 |
ggtgtggatgagatgatttcgttgcctacaaggaggtaacggattagggtttgtgggtaataaggtagaatgttggatttgatccattggtcggagaggg |
18858156 |
T |
 |
| Q |
201 |
tttggtttgatgagatgtttgtgatga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18858155 |
tttggtttgatgagatgtttgtgatga |
18858129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University