View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18793_low_24 (Length: 283)
Name: NF18793_low_24
Description: NF18793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18793_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 157 - 270
Target Start/End: Complemental strand, 18858462 - 18858349
Alignment:
| Q |
157 |
gatttagtccggtttaaaaacctaagcatcggtttaataacttgaaccgctatatctttacgaaacgcagcgtttgaaggtggaaaagaagtttctagaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18858462 |
gatttagtccggtttaaaaacctaagcatcggtttaataacttgaaccgctatatctttacgaaacgcagcgtttgaaggtggaaaagaagtttctagaa |
18858363 |
T |
|
| Q |
257 |
catccatagcagaa |
270 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18858362 |
catccatagcagaa |
18858349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 18858602 - 18858494
Alignment:
| Q |
17 |
caaataaattcgtataaaccaaacccgaacccggatccttaaccgtaacattactctctctaaacaaagcataatccaaattaacattaaccgggtcgga |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18858602 |
caaacaaattcgtataaaccaaacccgaacccggatccttaaccgtaacattactctctctaaacaaagcataatccaaattaacattaaccgggtcgga |
18858503 |
T |
|
| Q |
117 |
gctccaagg |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
18858502 |
gctccaagg |
18858494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University