View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_17 (Length: 402)
Name: NF18796_high_17
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 13 - 387
Target Start/End: Original strand, 21466831 - 21467205
Alignment:
| Q |
13 |
aatatttctggttcgataccggcttcaatttcgaatcatacaaatttgataaagctgcagttagatacaaatgagatatcaggtttgattccagttgaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466831 |
aatatttctggttcgataccggcttcaatttcgaatcttacaaatttgatacagttgcagttagatacaaatgagatatcaggtttgattccagttgaga |
21466930 |
T |
 |
| Q |
113 |
ttggaaagttgacgaagctagcggtctttttcgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgaggcttt |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466931 |
ttggaaagttgacgaagctgacggtttttttcgcttggcagaacaaacttgaaggtagaattccatcagagttaggagattgtgtaagccttgaggcttt |
21467030 |
T |
 |
| Q |
213 |
ggatttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatctctggc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467031 |
ggatttgtcttataattcactcagtgatagtttaccttcaggtctttttaagcttcaaaacttaacaaagcttttgttgatttctaatgatatctctggc |
21467130 |
T |
 |
| Q |
313 |
tctattcctcatgagattggtaactgtagttctctgattcgactccggcttttagataacagaatcagtggtgag |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467131 |
tctattcctcatgagattggtaactgtagttctctgattcgactccggcttttagataacagaatcagtggtgag |
21467205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University