View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_27 (Length: 308)
Name: NF18796_high_27
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 95 - 289
Target Start/End: Complemental strand, 48047418 - 48047229
Alignment:
| Q |
95 |
tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaactacatgc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047418 |
tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaactacatgc |
48047319 |
T |
 |
| Q |
195 |
atgcatgcatatgttaccgtgttgcatgtttggagttcaataaaaatacgattacaataactgcaaaatctagtttactcttgtagtatctatct |
289 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047318 |
at----gcatatgttaccgtgttgcatgtttggagttcaa-gaaaatacgagtacaataactgcaaaatctagtttactcttgtagtatctatct |
48047229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 48047515 - 48047481
Alignment:
| Q |
1 |
ggaattgcatattgagatgaaaatgttggtatatt |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047515 |
ggaattgcatattgagatgaaaatgttggtatatt |
48047481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 48039186 - 48039158
Alignment:
| Q |
2 |
gaattgcatattgagatgaaaatgttggt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48039186 |
gaattgcatattgagatgaaaatgttggt |
48039158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University