View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_28 (Length: 303)
Name: NF18796_high_28
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 38943138 - 38942869
Alignment:
| Q |
14 |
ttctgggtgggctttgatggagttgagacatccaagactgttcccatacttggtccccgtgtaaggtcgtcttttgatgaagtgtatttgcgaattgtat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| || |||| |||||| |
|
|
| T |
38943138 |
ttctgggtgggctttgatggagttgagacatccaagactgttcccatacttgctccccgtgtaagttcgtcttttgatgaagtgttttagcga-ttgtat |
38943040 |
T |
 |
| Q |
114 |
gtgcgaagaaaaccattgctcagctgactgatatacctgacgatggaacttttattgtaagtgcaactgttaatggattggttgaaggaatttagtagga |
213 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38943039 |
g--caaagaaaaccattgctcagctgactgatatacctgacgatggaacttttattgtaagtgcaactgttaatggattggttgaaggaatttagtagga |
38942942 |
T |
 |
| Q |
214 |
atgagagttatgaatatgactgtggttgggtggttgattgaattgcagggtaatttggaacgggaagtgattg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38942941 |
atgagagttatgaatatgactgtggttgggtggttgattgaattgcagggtaatttggaatgggaagtgattg |
38942869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University