View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_40 (Length: 259)
Name: NF18796_high_40
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 8056703 - 8056477
Alignment:
| Q |
16 |
ataatttgcttaatttggacaactaatcggtcttcatccatctcttaccnnnnnnnggggatctagtcatcatctcttgctccgaaactaccaaatgaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056703 |
ataatttgcttaatttggacaactaatcggtcttcatccatctcttaccaaaaaaagggaatcaagtcatcatctcttgctccgaaactaccaaatgaat |
8056604 |
T |
 |
| Q |
116 |
gggaagcttctacgaatgtgtctgcacacaattattcaattgacttcatcaaataaaataaccttcacctactnnnnnnnncaatcactttgatatcaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
8056603 |
gggaagcttctacgaatgtgtctgcacacaattattcaattgacttcatcaaataaaataaccttcacctact-aaataaacaatcactttgataccaaa |
8056505 |
T |
 |
| Q |
216 |
tgtttttgaaattgcaacctcatctttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8056504 |
tgtttttgaaattgcaacctcatctttg |
8056477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University