View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18796_high_49 (Length: 238)

Name: NF18796_high_49
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18796_high_49
NF18796_high_49
[»] chr8 (1 HSPs)
chr8 (13-221)||(43450950-43451158)


Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 43451158 - 43450950
Alignment:
13 aagaatattgagtttcaggggctgagtttaaataggctggtgttgtccaatattttgaagattttaggggatggaggactcttggagagactctttgagg 112  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451158 aagaaaattgagtttcaggggctgagtttaaataggctggtgttgtccaatattttgaagattttaggggatggaggactcttggagagactctttgagg 43451059  T
113 atataacagcgcgagggaggatatgctgctcgaactgctgctcaaaagttcaactgatgtatccctttcggaccacattggctgcaggaatcaatagaaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451058 atataacagcgcgagggaggatatgctgctcgaactgctgctcaaaaattcaactgatgtatccctttcggaccacattggctgcaggaatcaatagaaa 43450959  T
213 aggaaaagt 221  Q
    |||||||||    
43450958 aggaaaagt 43450950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University