View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_49 (Length: 238)
Name: NF18796_high_49
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 43451158 - 43450950
Alignment:
| Q |
13 |
aagaatattgagtttcaggggctgagtttaaataggctggtgttgtccaatattttgaagattttaggggatggaggactcttggagagactctttgagg |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451158 |
aagaaaattgagtttcaggggctgagtttaaataggctggtgttgtccaatattttgaagattttaggggatggaggactcttggagagactctttgagg |
43451059 |
T |
|
| Q |
113 |
atataacagcgcgagggaggatatgctgctcgaactgctgctcaaaagttcaactgatgtatccctttcggaccacattggctgcaggaatcaatagaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451058 |
atataacagcgcgagggaggatatgctgctcgaactgctgctcaaaaattcaactgatgtatccctttcggaccacattggctgcaggaatcaatagaaa |
43450959 |
T |
|
| Q |
213 |
aggaaaagt |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
43450958 |
aggaaaagt |
43450950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University