View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18796_high_52 (Length: 237)

Name: NF18796_high_52
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18796_high_52
NF18796_high_52
[»] chr5 (1 HSPs)
chr5 (73-174)||(3417941-3418040)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 73 - 174
Target Start/End: Original strand, 3417941 - 3418040
Alignment:
73 gtgaccatgagtcatgtgtcacgccagttcaacacagtttaatttattttannnnnnnngagggaacagtttaaaatatatgcgtgttaagtttcttgtg 172  Q
    |||||||||||||||||||||||||||||||||||||||||| || ||||         |||||||||||||||||||||||||||||||||||||||||    
3417941 gtgaccatgagtcatgtgtcacgccagttcaacacagtttaaattttttt--tttttttgagggaacagtttaaaatatatgcgtgttaagtttcttgtg 3418038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University