View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_high_57 (Length: 223)
Name: NF18796_high_57
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 6959191 - 6959005
Alignment:
| Q |
18 |
acaagatggccaccgtaaaacctgcttgaaattccaatattattcttgcggtgatactacataattcattggcttaaatgatcagccagtcccacaacta |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6959191 |
acaagatggccaccataaaacctgcttgaaattccaatattattctcgcggtgatactacataattcattggcttaaatgatcagccagtcccacaacta |
6959092 |
T |
 |
| Q |
118 |
aaaagcatctcaaaggagtcctttaatataaatatcgtaaatggtgttgtgattttggtatgttttgggttttgaaattttggggat |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6959091 |
aaaagcatctcaaagtagtcctttaatataaatatcgtaaatggtgttgtgattttggtatgttttgggttttgaaattttggggat |
6959005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 13280007 - 13279968
Alignment:
| Q |
165 |
tgtgattttggtatgttttgggttttgaaattttggggat |
204 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
13280007 |
tgtgaatttggtatgtttttggttttgaaattttggggat |
13279968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University