View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_low_23 (Length: 341)
Name: NF18796_low_23
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 51 - 323
Target Start/End: Original strand, 34361720 - 34361987
Alignment:
| Q |
51 |
acatattgagagtcattattaaccaacgtaacttcattaacaataaatttaaacataattaacattaatttgtgaaccttgaaggctaaataaagatagg |
150 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34361720 |
acatatcgagattcattattaaccaacgtaacctcattaacaataaatttaaacataattaacattaatttgtgaaccttgaaggttaaataaagatagg |
34361819 |
T |
|
| Q |
151 |
gaaatgctttatcaagttgtatttgaatatgtattttgtactctgattagataaaagtacatacaaaactgtctttctcatcctttgaccaagtaaattg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
34361820 |
gaaatgctttatcaagttgtatttgaatatgtattttgtactctgataagataaaagtacatacaaaactgtctttctcatcctttggccaagt-aattg |
34361918 |
T |
|
| Q |
251 |
catgttattccttcctgcaacatatcccgcattgacaatgacatgaaactttatcaaacacatgataaaaggt |
323 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361919 |
catgtta----ttcctgcaacatatcccgcattgacaatgacatgaaactttatcaaacacatgataaaaggt |
34361987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University