View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18796_low_31 (Length: 308)

Name: NF18796_low_31
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18796_low_31
NF18796_low_31
[»] chr1 (3 HSPs)
chr1 (95-289)||(48047229-48047418)
chr1 (1-35)||(48047481-48047515)
chr1 (2-30)||(48039158-48039186)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 95 - 289
Target Start/End: Complemental strand, 48047418 - 48047229
Alignment:
95 tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaactacatgc 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48047418 tatagtgaggaaaatgaaattggagaagactgataaccaacctcatcatcgtgtaatcttcaaattgagagttgtgaattgtgatatactaactacatgc 48047319  T
195 atgcatgcatatgttaccgtgttgcatgtttggagttcaataaaaatacgattacaataactgcaaaatctagtttactcttgtagtatctatct 289  Q
    ||    ||||||||||||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
48047318 at----gcatatgttaccgtgttgcatgtttggagttcaa-gaaaatacgagtacaataactgcaaaatctagtttactcttgtagtatctatct 48047229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 48047515 - 48047481
Alignment:
1 ggaattgcatattgagatgaaaatgttggtatatt 35  Q
    |||||||||||||||||||||||||||||||||||    
48047515 ggaattgcatattgagatgaaaatgttggtatatt 48047481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 48039186 - 48039158
Alignment:
2 gaattgcatattgagatgaaaatgttggt 30  Q
    |||||||||||||||||||||||||||||    
48039186 gaattgcatattgagatgaaaatgttggt 48039158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University