View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_low_43 (Length: 262)
Name: NF18796_low_43
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 41955543 - 41955774
Alignment:
| Q |
17 |
atactttacacttaagaactttacttgaagatgcatgctctcaaccagaaacaaaaatattctcgcccatccaatagtccccactctatttcacatctca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41955543 |
atactttacacttaagaactttacttgaagatgcatgctctcaaccagaaacaaaaatattcttgcccatccaatagtccccactctatttcacat---- |
41955638 |
T |
|
| Q |
117 |
ttcatcctttcccctatttgtgtatgtcttattagccaggttcaccatgcatgggtatattaactcccatcatttttaacccaaaagaaaaccaaataaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41955639 |
-tcatcctttcccctatttgtgtatgtcttattagccaggttcaccatgcatgggtatattaactcccatcatttttaacccaaaagaaaaccaaataaa |
41955737 |
T |
|
| Q |
217 |
taaaagcctatccattactcacgataatattgatgat |
253 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41955738 |
taaaagcttatccattactcacgataatattgatgat |
41955774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University