View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18796_low_46 (Length: 259)

Name: NF18796_low_46
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18796_low_46
NF18796_low_46
[»] chr5 (1 HSPs)
chr5 (16-243)||(8056477-8056703)


Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 8056703 - 8056477
Alignment:
16 ataatttgcttaatttggacaactaatcggtcttcatccatctcttaccnnnnnnnggggatctagtcatcatctcttgctccgaaactaccaaatgaat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||| ||| ||||||||||||||||||||||||||||||||||||    
8056703 ataatttgcttaatttggacaactaatcggtcttcatccatctcttaccaaaaaaagggaatcaagtcatcatctcttgctccgaaactaccaaatgaat 8056604  T
116 gggaagcttctacgaatgtgtctgcacacaattattcaattgacttcatcaaataaaataaccttcacctactnnnnnnnncaatcactttgatatcaaa 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||| ||||    
8056603 gggaagcttctacgaatgtgtctgcacacaattattcaattgacttcatcaaataaaataaccttcacctact-aaataaacaatcactttgataccaaa 8056505  T
216 tgtttttgaaattgcaacctcatctttg 243  Q
    ||||||||||||||||||||||||||||    
8056504 tgtttttgaaattgcaacctcatctttg 8056477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University