View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_low_48 (Length: 250)
Name: NF18796_low_48
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_low_48 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 83 - 250
Target Start/End: Complemental strand, 8056866 - 8056699
Alignment:
| Q |
83 |
ttgtagaatcaatttgtcgtgaccatagaagctataattggttgcttaatgtaaacccatttctatatatgaaaattgatccacttcaaagcatcaacca |
182 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056866 |
ttgtagaatcaatttgtcatcaccatagaagctagaattggttgcttaatgtaaacccatttctatatatgaaaattgatccacttcaaagcatcaacca |
8056767 |
T |
|
| Q |
183 |
aacaactttacaagatggtcaaaccatgtttgactcatgccaacgcacgttcataccaacaaaataat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056766 |
aacaactttacaagatggtcaaaccatgtttgactcatgccaacgcacgttcataccaacaaaataat |
8056699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 75
Target Start/End: Complemental strand, 8057260 - 8057202
Alignment:
| Q |
16 |
ataacatcacgacatagcaaacttatacatttatccaacttattgtttgccagctaaata |
75 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
8057260 |
ataacatcacaacatagcaaacttatac-tttatcccacttattgtttgccagctaaata |
8057202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University