View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_low_50 (Length: 248)
Name: NF18796_low_50
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 11813643 - 11813861
Alignment:
| Q |
18 |
agaaaaatactcaacaacataagaattcatctnnnnnnncccaataaatagaattaaacaaca--aatgaataaaatcagagatatcttgcacgtaagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11813643 |
agaaaaatactcaacaacataagagttcatctaaaaaa-cccaataaatagaattaaacaacataaatgaataaaaccagagatatcttgcacgtaagaa |
11813741 |
T |
|
| Q |
116 |
tttcttctccaccttgatttattttctccctttcccatccgtgttggtattcttcattgaagactccttacgcaactttattttctcatgtccttctttc |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11813742 |
tttcttctccaacttgatttattttctccatttcccatccgtgttggtattcttcattgaatactccttacgcaactttattttctcatgtcc----ttc |
11813837 |
T |
|
| Q |
216 |
tctttgcgtattcgttcttcttct |
239 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
11813838 |
tctttgcgtattcgttctccttct |
11813861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University