View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18796_low_51 (Length: 243)
Name: NF18796_low_51
Description: NF18796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18796_low_51 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 21466535 - 21466777
Alignment:
| Q |
1 |
atagtacttcaatttctggtgaaattcctcatgaaattggtaactgttctgagctagtgaacttgtttttgtatgagaatgatctttctggtgagattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466535 |
atagtacttcaatttctggtgaaattcctcatgaaattggtaactgttctgagcttgtgaacttgtttttgtatgagaatgatctttctggtgagattcc |
21466634 |
T |
 |
| Q |
101 |
ttttgagataggtaagcttatgaagcttgaaaagattttgctatggcaaaatagttttgttggtagcatacctgaggaaattggaaactgtagtagtttg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466635 |
ttttgagataggtaagcttgtgaagcttgaaaagattttgctatggcaaaatagttttgttggtagcatacctgaggaaattggaaactgtagtagtttg |
21466734 |
T |
 |
| Q |
201 |
aagattcttgatttttctttgaattatttctctggtggaatac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466735 |
gagattcttgatttttctttgaattatttctctggtggaatac |
21466777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University