View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18797_high_10 (Length: 261)
Name: NF18797_high_10
Description: NF18797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18797_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 38143869 - 38143636
Alignment:
| Q |
16 |
cacaagcaagtgggtggaaaacaatgtcatcaattgcgcctaagcgagggtgagccccgtcatgcaattcaaggttgatggcattgaatgcagcctcagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38143869 |
cacaagcaagtgggtggaaaacaatgtcatcaattgcgcctaagcgagggtgagccccatcatgcaattcaaggttgatggcattgaatgcagcctcagc |
38143770 |
T |
|
| Q |
116 |
catggccagcacagtttgttgcaggggactgtatatggcatttcctgtacagtcatgcaaaacatacgacacaaggctataccttgcccgattgtaagct |
215 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38143769 |
catggccagcacaatttgttgcaggggattgtatatggcatttcctgtacagtcatgcaaaacatacgacacaaggctataccttgcccgattgtaagct |
38143670 |
T |
|
| Q |
216 |
ctatcatgaaatttgtgcacaatgacagtttctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
38143669 |
ctatcatgaaatttgtgcacaatgacaatttctg |
38143636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 38134900 - 38134667
Alignment:
| Q |
16 |
cacaagcaagtgggtggaaaacaatgtcatcaattgcgcctaagcgagggtgagccccgtcatgcaattcaaggttgatggcattgaatgcagcctcagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||| ||||||| ||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38134900 |
cacaagcaagtgggtggaaaacaatgtcatcaactgcacctaagcgggggtgagacccatcatgcaattcaaggttgatggtgttgaatgcagcctcagc |
38134801 |
T |
|
| Q |
116 |
catggccagcacagtttgttgcaggggactgtatatggcatttcctgtacagtcatgcaaaacatacgacacaaggctataccttgcccgattgtaagct |
215 |
Q |
| |
|
|||||||| |||||||||||| | ||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||| | |
|
|
| T |
38134800 |
catggccaccacagtttgttgtaaggggctgtatatggcatttcctgtgcagtcatgcaaaacatatgacacaaggctataccttgcccggttgtaagat |
38134701 |
T |
|
| Q |
216 |
ctatcatgaaatttgtgcacaatgacagtttctg |
249 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||| |
|
|
| T |
38134700 |
ctaccatgaaatttgttcacaatgacagtttctg |
38134667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University