View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18797_high_14 (Length: 236)
Name: NF18797_high_14
Description: NF18797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18797_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37497813 - 37498032
Alignment:
| Q |
1 |
tttctgttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataaggtctaattcgcagccagagatattaaaaccttgatgttgtaaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497813 |
tttctgttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataaggtctaattcgcagccagagatattaaaaccttgatgttgtaaccc |
37497912 |
T |
|
| Q |
101 |
aaattgcagtcgtgagtgggctagtggataggcattggtcattcaaataacattttcattgtttatttccaactacaatcatatctatgctactcttatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497913 |
aaattgcagtcgtgagtgggctagtggataggcattggtcattcaaataacattttcattgtttatttccaactacaatcatatctatgctactcttatg |
37498012 |
T |
|
| Q |
201 |
tacatgtaagctagacagta |
220 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
37498013 |
tacatgtaaactagacagta |
37498032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 32618778 - 32618729
Alignment:
| Q |
6 |
gttgcgatcattgatattgtagagaattgctgtcaaatgtggctgataag |
55 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
32618778 |
gttgcgatatttgatattgtagagtattgcagtcaaatgcggctgataag |
32618729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University