View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18797_high_15 (Length: 203)
Name: NF18797_high_15
Description: NF18797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18797_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 5828185 - 5828105
Alignment:
| Q |
5 |
gtgggtagattatactatatgttgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg |
85 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828185 |
gtgggtatattatattatatgttgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg |
5828105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 185
Target Start/End: Complemental strand, 5828063 - 5828004
Alignment:
| Q |
127 |
tcgtggaggcttttggactttggaa-gctgcaaaatttggcaaggaatatgtattttagt |
185 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5828063 |
tcgtggaggcgtttggactttggaaagctgcaaaatttggcaaggaatatgtattttagt |
5828004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University