View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18797_low_18 (Length: 203)

Name: NF18797_low_18
Description: NF18797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18797_low_18
NF18797_low_18
[»] chr4 (2 HSPs)
chr4 (5-85)||(5828105-5828185)
chr4 (127-185)||(5828004-5828063)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 5828185 - 5828105
Alignment:
5 gtgggtagattatactatatgttgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg 85  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5828185 gtgggtatattatattatatgttgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg 5828105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 185
Target Start/End: Complemental strand, 5828063 - 5828004
Alignment:
127 tcgtggaggcttttggactttggaa-gctgcaaaatttggcaaggaatatgtattttagt 185  Q
    |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
5828063 tcgtggaggcgtttggactttggaaagctgcaaaatttggcaaggaatatgtattttagt 5828004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University