View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18799_high_2 (Length: 624)
Name: NF18799_high_2
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18799_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 565; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 565; E-Value: 0
Query Start/End: Original strand, 18 - 611
Target Start/End: Complemental strand, 39587060 - 39586461
Alignment:
| Q |
18 |
atgtttcacaaaaaatgacactattttagcaaaccggccacctcttctggcaggcaaacacatcggatacaactacaccgcggtaaccgttgctccttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39587060 |
atgtttcacaaaaaatgacactattttagcaaaccggccacctcttctggcaggcaaacacatcggatacaactacaccgcggtaaccgttgctccttat |
39586961 |
T |
|
| Q |
118 |
ggcgatcactggcgtaacgtccgtcgtataatctcccttgacgttctctcaacacaccgtttaaactcatttttacgtattagaaaaaacgaaatcatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586960 |
ggcgatcactggcgtaacgtccgtcgtataatctcccttgacgttctctcaacacaccgtttaaactcatttttacgtattagaaaaaacgaaatcatga |
39586861 |
T |
|
| Q |
218 |
aactcatgcaagccctagctcgtggttctagttctag------cgacggttttgcgagagtggagttgaaaacaaagctttcggagatgacttttaacac |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586860 |
aactcatgcaagccctagctcgtggttctagttctagttctagcgacggttttgtgagagtggagttgaaaacaaagctttcggagatgacttttaacac |
39586761 |
T |
|
| Q |
312 |
gataatgagaatgatatctggaaagagatattatggtgaggattgtgatgtgagtgatgaagaagaagctaagggatttagggagatgattaaggagatg |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586760 |
gataatgagaatgatatctggaaagagatattatggtgaggattgtgatgtgagtgatgaagaagaagctaagggatttagggagatgattaaggagatg |
39586661 |
T |
|
| Q |
412 |
gtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggttcgattttggtggttatgaaaagaagttgaaaaggattgcaagaa |
511 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586660 |
gtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggtttgattttggtggttatgaaaagaagttgaaaaggattgcaagaa |
39586561 |
T |
|
| Q |
512 |
gatttgatgggtttttgcagggtttgattgatgagcataggaggaagaaggagaaggggaataacatgattgatcatctcttgaacttgcaagaattatc |
611 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586560 |
gatttgatgggtttttgcaaggtttgattgatgagcataggaggaagaaggagaaggggaataacatgattgatcatctcttgaacttgcaagaattatc |
39586461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 316 - 356
Target Start/End: Original strand, 38954399 - 38954439
Alignment:
| Q |
316 |
atgagaatgatatctggaaagagatattatggtgaggattg |
356 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
38954399 |
atgagaatgatctctggaaagagatactatggtgatgattg |
38954439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 290 - 370
Target Start/End: Original strand, 5884330 - 5884410
Alignment:
| Q |
290 |
tttcggagatgacttttaacacgataatgagaatgatatctggaaagagatattatggtgaggattgtgatgtgagtgatg |
370 |
Q |
| |
|
||||||| ||||| ||||| || |||||||||||| | || || || ||||| ||||| | ||||||||||||||||||| |
|
|
| T |
5884330 |
tttcggaaatgacatttaatactataatgagaatggtgtcggggaaaagatactatggaaatgattgtgatgtgagtgatg |
5884410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University