View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18799_high_20 (Length: 232)
Name: NF18799_high_20
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18799_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 2131219 - 2131017
Alignment:
| Q |
13 |
gaagaatatcacaacaaagatatgaagtccataaaatttaggagaatcttgtctcaagtcccaattgcaagtcaaaagtgaacatgtcaagtgaaggagg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131219 |
gaagaaaatcacaacaaagatatgaagtccataaaatttaggagaatcttgtctcaagtcccaattgcaagtcaaaagtgaacatgtcaagtgaaggagg |
2131120 |
T |
|
| Q |
113 |
cctaagatgcgcacaccttgcatgcgagtatagtctgtgatgtgtacactgaaagaacattggagttcctcttggcctcacacgtggtgtgcgtgctgat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131119 |
cctaagatgcgcacaccttgcatgcgagtatagtctgtgatttgtacactgaaagaacataggagttcctcttggcctcacacgtggtgtgcgtgctgat |
2131020 |
T |
|
| Q |
213 |
cgt |
215 |
Q |
| |
|
||| |
|
|
| T |
2131019 |
cgt |
2131017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University