View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18799_low_11 (Length: 309)

Name: NF18799_low_11
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18799_low_11
NF18799_low_11
[»] chr3 (2 HSPs)
chr3 (196-297)||(36916464-36916565)
chr3 (18-85)||(36916286-36916353)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 196 - 297
Target Start/End: Original strand, 36916464 - 36916565
Alignment:
196 cttgccttaaattgaacacaagttcctttcgtaaaaaagatactacgtgtggtgcaaggaatattcctcaaatttctagctgtgtctatgacgtatgaaa 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
36916464 cttgccttaaattgaacacaagttcctttcgtaaaaaagatactacgtgtggtgcaaggaatattcctcaaatttctagctgtgtctatgacgtgtgaaa 36916563  T
296 ca 297  Q
    ||    
36916564 ca 36916565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 36916286 - 36916353
Alignment:
18 ttcaggcggagggaggtgagggatggtggatgatgacgtcatgtttccgatcccgattgattgatcgg 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36916286 ttcaggcggagggaggtgagggatggtggatgatgacgtcatgtttccgatcccgattgattgatcgg 36916353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University