View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18799_low_11 (Length: 309)
Name: NF18799_low_11
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18799_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 196 - 297
Target Start/End: Original strand, 36916464 - 36916565
Alignment:
| Q |
196 |
cttgccttaaattgaacacaagttcctttcgtaaaaaagatactacgtgtggtgcaaggaatattcctcaaatttctagctgtgtctatgacgtatgaaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36916464 |
cttgccttaaattgaacacaagttcctttcgtaaaaaagatactacgtgtggtgcaaggaatattcctcaaatttctagctgtgtctatgacgtgtgaaa |
36916563 |
T |
 |
| Q |
296 |
ca |
297 |
Q |
| |
|
|| |
|
|
| T |
36916564 |
ca |
36916565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 36916286 - 36916353
Alignment:
| Q |
18 |
ttcaggcggagggaggtgagggatggtggatgatgacgtcatgtttccgatcccgattgattgatcgg |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36916286 |
ttcaggcggagggaggtgagggatggtggatgatgacgtcatgtttccgatcccgattgattgatcgg |
36916353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University