View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18799_low_18 (Length: 252)
Name: NF18799_low_18
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18799_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 31450428 - 31450210
Alignment:
| Q |
16 |
attcttgaagaaaaaggaagaaaggtttcaagacttgtgcgagcacataaaactaaagacgacttattctgcatgtctagagccaacaacactattaatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31450428 |
attcttgaagaaaaaggaagaaaggtttcaagacttgtgcgagcacataaaactaaagacgacttattctgcatgtctagagccaaca---ctattaatc |
31450332 |
T |
|
| Q |
116 |
tcaaaaagatatatcagaagatgtgactttggttgattctatggatctgtatataaaaaagcctaaaatattctttcatcatgaattaatatttttgtca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| | || |
|
|
| T |
31450331 |
tcaaaaagatatatcagaagatgtgactttggttgattctatggatctgtatataaaattgcctaaaatattctttcatcatgatttaatattttaggca |
31450232 |
T |
|
| Q |
216 |
tttgacattctaaatgtatacc |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31450231 |
tttgacattctaaatgtatacc |
31450210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University