View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18799_low_20 (Length: 240)

Name: NF18799_low_20
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18799_low_20
NF18799_low_20
[»] chr8 (1 HSPs)
chr8 (1-228)||(40179473-40179691)


Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 40179691 - 40179473
Alignment:
1 gtgtcactttgagcccccctacaatgttggatttcttagcatttggtgctttgaatgcactgttaaccatatttccattcatgtttgtctcattgttttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||         ||||||||||||||||||||    
40179691 gtgtcactttgagcccccctacaatgttggatttcttagcatttggtgctttgaatggactgttaaccata---------atgtttgtctcattgttttc 40179601  T
101 ctcctcagtgctccattccattttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40179600 ctcctcagtgctccattccattttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaacgccggcaca 40179501  T
201 ccttcaactggatcaccattctctgctc 228  Q
    ||||||||| ||||||||||||||||||    
40179500 ccttcaacttgatcaccattctctgctc 40179473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University