View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18799_low_21 (Length: 234)
Name: NF18799_low_21
Description: NF18799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18799_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 101 - 215
Target Start/End: Complemental strand, 33111758 - 33111645
Alignment:
| Q |
101 |
taagtgatttattggattttagacctttggattgagtgaaccnnnnnnngaggctgtcacaaaggctccttgaatcaagtttggctgatttccgaatctc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33111758 |
taagtggtttattggattttagacctttggattgagtgaaccaaaaaaagaggctgttacaaaggctccttgaatcaagtttggctgatttccgaatct- |
33111660 |
T |
 |
| Q |
201 |
ccaccaaaagttgat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33111659 |
ccaccaaaagttgat |
33111645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 33111858 - 33111804
Alignment:
| Q |
1 |
tttgttgcttgattgcaatttttgcagaaggacgaggaggcatgtctatttttag |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33111858 |
tttgttgcttgattgtaatttttgcagaaggacgaggtggcatgtctatttttag |
33111804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University