View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1879_high_16 (Length: 246)
Name: NF1879_high_16
Description: NF1879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1879_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 53635585 - 53635814
Alignment:
| Q |
8 |
attattctatatgtatccaccatgtgatgttttgtactctgattttgtctttttgcagaagaagaagaaga------tctagaacggaacttcaggagaa |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
53635585 |
attattctatatgtatccaccgtgtgatgttttgtactctgattttgtctttttgcagaagaagaagaagaagaagatctagaaca-aacttcaggagaa |
53635683 |
T |
 |
| Q |
102 |
ttcgtccacaattatgagctagaaaaatgtggttttaacgatctcttccttagtttaaaccaaatgagttttgtgaagtacaatatttatactttaagct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53635684 |
ttcgtccacaattatgagctagaaaaatgtggttttaacgatctcttccttagtttaaaccaaatgagttttgtgaagtacaatatttatactttaatct |
53635783 |
T |
 |
| Q |
202 |
ctagcaaatatcatcgtatgaatgttgaatt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53635784 |
ctagcaaatatcatcgtatgaatgttgaatt |
53635814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University