View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1879_high_18 (Length: 238)
Name: NF1879_high_18
Description: NF1879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1879_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 121 - 222
Target Start/End: Original strand, 2240469 - 2240570
Alignment:
| Q |
121 |
cgataaggaaggaattgatcaatcccacttgaattaagtagtactacgatatggaattatggggcagtagttattaaagctatactcaaagttgcaagaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2240469 |
cgataaggaaggaattgatcaatcccacttgaattaagtagtactacgatatggaattatggggcagtagttattaaacctatactcaaagttgcaagaa |
2240568 |
T |
|
| Q |
221 |
ac |
222 |
Q |
| |
|
|| |
|
|
| T |
2240569 |
ac |
2240570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2240381 - 2240474
Alignment:
| Q |
1 |
ttggggctagaaaacacgatcaaatatatgagatctagagtttaaactctagtttctaca-taac----attcttttataaaagaataccataa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||| |
|
|
| T |
2240381 |
ttggggctagaaaacacgatcaaatatatgagatctagagtttaaactctagtttctacagtaacattaattcttttataaaagaatacgataa |
2240474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University