View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1879_low_19 (Length: 238)

Name: NF1879_low_19
Description: NF1879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1879_low_19
NF1879_low_19
[»] chr6 (2 HSPs)
chr6 (121-222)||(2240469-2240570)
chr6 (1-89)||(2240381-2240474)


Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 121 - 222
Target Start/End: Original strand, 2240469 - 2240570
Alignment:
121 cgataaggaaggaattgatcaatcccacttgaattaagtagtactacgatatggaattatggggcagtagttattaaagctatactcaaagttgcaagaa 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
2240469 cgataaggaaggaattgatcaatcccacttgaattaagtagtactacgatatggaattatggggcagtagttattaaacctatactcaaagttgcaagaa 2240568  T
221 ac 222  Q
    ||    
2240569 ac 2240570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2240381 - 2240474
Alignment:
1 ttggggctagaaaacacgatcaaatatatgagatctagagtttaaactctagtttctaca-taac----attcttttataaaagaataccataa 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    |||||||||||||||||||| ||||    
2240381 ttggggctagaaaacacgatcaaatatatgagatctagagtttaaactctagtttctacagtaacattaattcttttataaaagaatacgataa 2240474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University