View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1879_low_6 (Length: 424)
Name: NF1879_low_6
Description: NF1879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1879_low_6 |
 | |
|
| [»] scaffold0005 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 255795 - 255612
Alignment:
| Q |
11 |
atgaatgaatgcatttataaggatgatgttttggtttcaatgagaagagcactagaactcaaagctttgaagaagaataacaagaaacnnnnnnngaatt |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
255795 |
atgaatgaatgcatttataaagatgatgtcttggtttcaatgagaagagcacgagaactcaaagctttgaagaagaataacaagaaacaaaaaaagaatt |
255696 |
T |
|
| Q |
111 |
gctacttgaaatactttgaatgctttcagtgtttttggtttcttcttggttgtggtaccaaatcttatgattagattaaatata |
194 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
255695 |
gctacttgaaatactttgaatgctttcggtgtttgtggtttcttcttggttgtggtaccaaatcttatgattagattaaatata |
255612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 260 - 409
Target Start/End: Complemental strand, 255544 - 255395
Alignment:
| Q |
260 |
tccttgtaaccttcaaattttgtggactatcttaaggacgaggacaagaattttaattttgattagcaatctttatcaaagaaagtaaacttgcttaact |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| | |
|
|
| T |
255544 |
tccttgtaaccttcaaattttgtggactatcttaaggacgaggacaagaattttaattttgatttgcaatctttatcaaagaaagtaaacttgtttaatt |
255445 |
T |
|
| Q |
360 |
caagattggtttttatttgtttgttacaagttcccgtgcacatatgattt |
409 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
255444 |
caagattggtttttatttgtttgtttcaagttcccgtgcacatatgattt |
255395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University