View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18800_low_9 (Length: 235)
Name: NF18800_low_9
Description: NF18800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18800_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41335708 - 41335942
Alignment:
| Q |
1 |
tttcagcagtttcctttcatgaataatggctttgattcaagtacttcaaatgtttctttcccatttcaaagtgaaattgttgaaccaacaactacttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41335708 |
tttcagcagtttcctttcatgaataatggctttgattcaagtacttcaaatgtttctttcccatttcaaagtgaaattgttgaaccaacaactacttcta |
41335807 |
T |
 |
| Q |
101 |
gggttactactttgatgcctgcatcggttaaatcggaacacaacggaggttttaatctgcttagatctccaatgaatatgtcagagaataacaaccatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41335808 |
gggttactactttgatgcctgcatcggttaaatcggaacacaacggaggttttaatcttcttagatctccaatgaatatgtcagagaataacaaccatta |
41335907 |
T |
 |
| Q |
201 |
caataattcatggaatgattttcatggtcttgcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41335908 |
caataattcatggaatgattttcatggtcttgcat |
41335942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University