View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18801_low_1 (Length: 336)
Name: NF18801_low_1
Description: NF18801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18801_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 4 - 333
Target Start/End: Complemental strand, 1534360 - 1534031
Alignment:
| Q |
4 |
tcaagaagaacaagggtagggattgtgaggggtacattttaagaaaagaggataaggtgtcatttggaatgagaaagagaattggaaatctcttgaagtg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534360 |
tcaagaagaacaagggtagggattgtgaggggtacattttaagaaaagaggataaggtgtcatttggaatgagaaagagaattggaaatctcttgaagtg |
1534261 |
T |
 |
| Q |
104 |
agcacaaagcatgatgtttgaggagacgaagcatcaatgaaaaagaggcattctaaaataagaaaatccaagttctagctagtttgacgaaggctgagca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534260 |
agcacaaagcatgatgtttgaggagacgaagcatcaatgaaaaagaggcattctaaaataagaaaatccaagttctagctagtttgacgaaggctgagca |
1534161 |
T |
 |
| Q |
204 |
tcgaaagcccccttgcaattggaaggctatgacaacagaacatacttgaaggatattggatatctgaattggttgcatgaatttaatactcgtttggatt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534160 |
tcgaaagcccccttgcaattggaaggctatgacaacagaacatacttgaaggatattggatatctgaattggttgcatgaatttaatactcgtttggatt |
1534061 |
T |
 |
| Q |
304 |
taggttttatgtttggttgatgatgtccat |
333 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
1534060 |
taggttttatgtttggttgatgatggccat |
1534031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University