View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18802_high_11 (Length: 262)

Name: NF18802_high_11
Description: NF18802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18802_high_11
NF18802_high_11
[»] chr5 (1 HSPs)
chr5 (1-81)||(32796676-32796756)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 32796676 - 32796756
Alignment:
1 tttctaggaatgtgatctttgaagaacatatttttccacggatactaattctcctacaacaatatttatacaatgggaaag 81  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
32796676 tttctaggaatgtgatctttgaagaacatatttttccacggatcctaattctcctacaacaatatttatacaatgggaaag 32796756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University